stanza dna
stanza dna
stanza dna
stanza dna
stanza dna
stanza dna

VIEW   LAB

All code and dna source material thanks to the higher powers (maybe) and all testing MRC Clinical Sciences Centre Faculty of Medicine, Imperial College.

This code is derived from code made in 2003

"OPEN SOURCE:

code made from code made from blood represented by code"

By stanza.

The work represents my dna and each letter or base code appears on the screen for one second. The piece is cycling through all 3.3 billion letters of my dna code. At one second per letter, it will take more than one hundred and four years. The piece of work is time based and to make a note of the complete open source of my dna get a pencil and paper and start writing.

To be exhibited on large projectors so that the work is mirrored to represent the double helix. Also in a gallery space don't forget pencils and paper.

stanza dna source code

enter - time code PC platform online

enter - time code MAC platform online

------------------------------------------------------------------------------------------------------------------

I am looking for an offline real gallery to exhibit this piece of work for one hundred and four years. This is is the length of timeit will take to take down the whole code at one letter per second.

See installation views below

stanza open source DNA

stanza open source DNA

Photos above by Stanza from installation view in Test Portal Amsterdam. 2005

GGCAGCAGGCAGGAACTTGTCGCAGGCAGGCAGCCTGGCAGCAGGCAGGAACCTTGTCGCAGGCAGGCAGCCTTGAGACAGTTCCTTGAGTTCCTTGAG

Download a sample of stanza open source code from chromosome 17.

GCAGACTGGCAGGCAGAACCTTGTCGCAGGCAGGCAGCCTTGAGACAGCCTTTTGAG

VIEW IMAGES FROM DNA  LAB 2003

 

Stanza DNA on the end of a stick

Image above shows Stanza DNA on the end of a stick ie my sequenced DNA. Image copyright stanza 2007

(this version of my DNA based artwoprks was funded by canada council for arts for year01.com)

------------------------------------------------------------------------------------------------------------------

Timer for clock

var SECOND = 1000; // the number of milliseconds in a second

var MINUTE = SECOND * 60; // the number of milliseconds in a minute

var HOUR = MINUTE * 60; // the number of milliseconds in an hour

var DAY = HOUR * 24; // the number of milliseconds in a day

var WEEK = DAY * 7; // the number of milliseconds in a week

var YEAR = WEEK * 52; //the number of milliseconds in a year

totalletters = 3300000000;

timeperletter = 1;

dtnow = new Date();

dtFinish = new Date(2005,5,9);

dtFinish.setSeconds( dtFinish.getSeconds() + (totalletters * timeperletter));

"OPEN SOURCE: code made from code made from blood represented by code"

The DNA clock is playing with the idea of a code clock, a system within a system. The clock, is a code for life that is represent by time. In fact to count or watch all the 3.3 billion letters will take one hundred and four years disclosing the 'meaning of life' in the process. By sitting in the gallery for one hundred and four years you will also have an exact replica of Stanza DNA and the source code to copy the artist via duplication (clone). Alternatively you can buy my DNA which will be auctioned on Ebay soon.

The original concept and intention as well as being developed as an artwork was to make a business. In short a database placed online would require users to submit a copy of their DNA. Once the first 100,000 subscriptions had been made then an IPO, an initial public offering would be made. The company formed on the stock market would exploit any patents, intellectual property and any derivable income would be shared among the subscribed user group. The shareholders in this company would be the subscribers who have placed their DNA source code. This project was to counter the exploitation of DNA by large corporations who do now exploit the right to this source code, a code that should be equally beneficial to all. This database is still in progress and further funds and financial backers are needed. This concept is copyright / and left. Stanza

The DNA is an operating system consists of 3.3 billion bases that is the letters ACTG. There are also the chromosomes and either the X or Y depending on if you are male or female. My thinking is if you remove parts of the operating system then you stop working. Indeed part of any OS consists of objects, functions or blocks of code that do specific jobs but also relate tasks to the whole. This idea is expanded when we consider that some of the code can actually change, evolve or shifts over time. An interesting term that relates to a huge chunk of the code sequence; in fact more than 95 percent of all DNA, was called "Junk DNA" by molecular biologists, because they were unable to ascribe any function to it. However the issue here is that the function of the code is not yet properly understood. What does the function do within the operating system?

Code represented by code and taken from blood.



To come soon.

Auction on ebay of stanza dna so you can clone me. (in the freezer)

Blood sample. (the original blood used for the project still in my fridge)

Stanza Metaphase plates for sale


There are some other projects and works associated with my dna sequence including musical interpretation and generative reworking of my DNA sequence online. See www.genomixer.com.

also see Mutations http://www.stanza.co.uk/mutations/index.html

Contact Stanza copyright 2005
Site design, build, blood and DNA by stanza

 

Thanks to everyone I have been asking for advice on this technical and scientific including Amanda Fisher, Kate Michaelides, Ruth Williams. Thanks also to everyone else I have been talking to about this project, this includes, Vicky Forrester, Daniel Glaser, Pelado, Sophie Dauvois. Thanks also to Cecilia Anderson who introduced me to some of these ideas while on a residency a couple of years back.

Special thanks to Adam Hoyle help with timers.