"OPEN SOURCE:
code made from code made from blood represented by code"
By stanza.
The work represents my dna and each letter or base code appears on the screen for one second. The piece is cycling through all 3.3 billion letters of my dna code. At one second per letter, it will take more than one hundred and four years. The piece of work is time based and to make a note of the complete open source of my dna get a pencil and paper and start writing.
To be exhibited on large projectors so that the work is mirrored to represent the double helix. Also in a gallery space don't forget pencils and paper.
I am looking for an offline real gallery to exhibit this piece of work for one hundred and four years. This is is the length of timeit will take to take down the whole code at one letter per second.
See installation views below


Photos above by Stanza from installation view in Test Portal Amsterdam. 2005
GGCAGCAGGCAGGAACTTGTCGCAGGCAGGCAGCCTGGCAGCAGGCAGGAACCTTGTCGCAGGCAGGCAGCCTTGAGACAGTTCCTTGAGTTCCTTGAG
Download a sample of stanza open source code from chromosome 17.
GCAGACTGGCAGGCAGAACCTTGTCGCAGGCAGGCAGCCTTGAGACAGCCTTTTGAG
VIEW IMAGES FROM DNA LAB 2003

Image above shows Stanza DNA on the end of a stick ie my sequenced DNA. Image copyright stanza 2007

(this version of my DNA based artwoprks was funded by canada council for arts for year01.com)
------------------------------------------------------------------------------------------------------------------