Inference Cell. 2008.

Cells and viruses project.More....

Cells and viruses project, software system.

The Binary Graffiti Club. 2015.

Public art and politics.More.....

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

Urban Generation. 2004

Real time experience. More.....

Stanza. Multiple surveillance cameras are accessed randomly in real time

Mind Map. 2015.

Vison of all knowledge. More

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Quantum Entanglement. 1996

Artworks on mirror or perspex. More......

Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.

The Reader. 2015.

Data scultpture. More...

Hybrid digital sculpture.

DNA CLOCK. 2005.

DNA system time clock. More....

Stanza DNA as artwork installation.

Youth Culture 2018.

A towering beautiful hooded sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Urban Generation. 2004.

Most images show events captured from across the city.

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Panic Noise Series. 1985

Video art systems. More......

Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza

Parallel Reality Series II. 2004-2010.

Using surveillance images to make time based art. More....

Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.

The Reader. 2015.

Data Sculpture. More....

Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Public Domain. 2008.

Visitors To A Gallery. More...

Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Visitors To A Gallery: Referential Self. 2004 +

Digtal Art More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Visitors are captured by the camera system in the gallery.

The Nemesis Machine. 2010-2019.

Networked city. More...

a large installation adapted to each place where it is displayed.

A large installation adapted to each place where it is displayed

The Central City. 1997.

Touch screen cities. More...

Private Collection

The Emergent City. At FOS 2019

Large scale installation always different. More......

Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.

Parallel Reality. 2004-2010.

Using custom made software and computer techniques. More...

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Visitors To A Gallery. 2004+

The audience as artwork. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Nemesis Machine. The Emergent City. 2019.

Installation of neworked real-time data. More....

Stanza netart, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Installation

Control Series III. 1993.

Oil on Canvas. More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Reader. 2015.

Data scultpture. More...

Hybrid digital sculpture.

Parallel Reality. 2004

Software System. More.....

Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.

Parallel Reality. 2004-2010.

More

Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Agency At The End Of Civilisation. 2014.

Data system of complicit surveillance. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Nemesis Machine. 2010-2019.

Data scultpture. More....

A large installation adapted to each place where it is displayed that is a miniature city.

Soul Of The City. 2004.

Installation for city wide public art. More....

Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Binary Graffiti Club 2019.

Public art spectacle. More...

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

Networks In The Emergent City. 2010

Analogies for the organic identity of the cityMore.....

The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza

Youth Culture. 2018.

Sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Sensity. Data Cities. 2006- 2009

Connecting space and visualising the landscape. More....

Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies

The Nemesis Machine. 2010-2019.

Data installation. More....

A large installation adapted to each place where it is displayed that is a miniature city.

Installation adapted to each place where it is displayed

The Emergent City at FOS 2019

More....

All artworks on this site by Stanza

The Nemesis Machine. 2010

Connecting city spaces through data. More...

All artworks on this site by Stanza

The Central City. 1997.

Labyrinth exhibited on 15 touch screens. More....

labyrinth exhibited on 15 touch screens

The Reader. 2015.

Data Sculpture and AI. More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Lost In Translation. 2015.

AI robots and public art.More...

Portait Of The Artist Stanza

Herd Above The Noise. Ongoing.

Sounds installation. More...

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

Interactive installation plays thousands of sounds from around the world.

Parallel Reality. 2004-2010

Time based digital artworks. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Sonicity. 2010.

Installation of sound. More....

Data as sound installation.

Touch Sreens Artworks 2004.

More...

Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.

The Nemesis Machine. 2010- 2019.

Large networked installation. More....

Available for exhibition.

Herd Above The Noise.

Sound art installation. More...

Installation

Installation plays thousands of sounds from around the world.

The Nemesis Machine. 2010-2019.

More......

All artworks on this site by Stanza

Capacities. 2010.

Using environmental data to make art. More....

Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.

The Nemesis Machine. 2010-2017.

Intelligent city. Evolving artwork. More

Intelligent city. Evolving artwork

Syncronicity: Infinite Possibilities.

Software system. More

Data Visualisation Computer,

Entropy Through Black Matter. 2014.

Connected space. More...

Portrait Of Artist Stanza. All artworks on this site by Stanza

The Third Space. 2012

Mixing up data spaces. More....

Works On Canvas. All 100 cm by 100 cm and signed.

The Agency At The End Of Civilisation. 2014

Systems of surveillance and control. More

The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza

Agency at The End Of Civilisation. 2014.

A digital art installation More....

The artists DNA as a building

>anipulating data and systems of surveillance into more systems of control.

Surface Scars and Cuts. 2010.

Complexity series. More....

Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza

The Agency At The End Of Civilisation. 2014.

More...

The Agency At The End Of Civilisation.

Body. 0100001001101111011001. 2014

About the perspectives of surveillance. More

A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza

Self Portrait of the artist as system of information.

The Nemesis Machine. 2010-2017.

Experience of data cities. More....

Intelligent city. Evolving artwork The City as System

Fortuna. 2010

The other side of experience. More....

The computer manipulates time experiences.

We Have Nothing To Hide. 2010.

Performance. More.....

Surveillance in Public Space

Body. (Self Portrait) 2012.

The data body as sculpture. More ...

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.

Self Portrait of the artist as system of information.

Visitors To A Gallery. 2004+

The audience as artwork. More..

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Urban Generation. 2004

networked city wide atwork. More.....

Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.

Sonicity. Invisible Worlds of Data. 2010

Sensors turn the invlsible world into sounds. More...

All artworks on this site by Stanza

Herd Above The Noise.

Sound installtion. More

The Database Of Global Sound

Installation plays thousands of sounds from around the world.

Parallel Realities. 2004-2010.

Time based system. More....

Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Visitors To A Gallery. 2004+

The audience as artwork. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Reader. 2015.

Data scultpture. More...

Hybrid digital sculpture.

The Nemesis Machine. 2010-2019.

Data installation. More....

A large installation adapted to each place where it is displayed that is a miniature city.

America Is Bleeding. 2005.

More....

The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.

The Nemesis Machine. 2010-2019.

Networked city. More....

a large installation adapted to each place where it is displayed that is a miniature city.

The Binary Graffiti Club

Public art and politics. More....

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

Parallel Reality. 2004-2010.

Time based expression of global perpectives. More...

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Sonicity. 2010.

More

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Panic Noise Series. 1985

Video art systems. More..

Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza

The Central City. 1997.

Installation of city based artworks. More....

Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

All Tomorrows Stories. 2002.

Live news feeds More...

Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Digital generative artworks using information that bombards us online.

Sonicity. 2010.

Invisible worlds of Sound. Installation More....

Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

You Are My Subjects. 2004.

The loss of privacy. More...

Stanza, netart, painting, networked space, installations.

Agency at The End Of Civilisation. 2014.

A visual labyrinth. Installation of screens.More....

A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza

DNA CLOCK. 2005

Runs for 107 years ATCG. More...

Installation

Installation

History Is Personal. 2008.

Stars Of CCTV. More....

These images represent a portrait of England since the start of the CCTV imaging revolution. These CCTV artworks are re-mediated as history paintings and represent a social portrait of England. All Image available for exhibition.

The Binary Graffiti Club.

Performance events about agency. More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Body 1010101. 2012.

The networked body. More..

Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza

Amorphoscapes. 2004.

Generative softare art. More....

Custom hardware and complex software systems as art.

The Nemesis Machine. 2010-2019.

Installation. More

A large installation adapted to each place where it is displayed that is a miniature city.

Incorporating data ownership, surveillance, real time urban environments

Soul of The City. 2004.

Interactive artwork. More....

Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Genomixer. Using the DNA sequence. 2004

DNA artworks. More

USing the artists DNA sequence.

ATCGTTCATAGTCCCATACCATTACCAATGGGATGATGTGATTAG

The Nemesis Machine. 2010-2019.

Installation of networked intelligence. More....

Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

An ever evolving artwork, always different and always expanding

Sonicity. Invisibe Worlds. 2010.

More...

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Panic Noise Series. 1985.

Video art systems. More.....

Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza

Data Data Data. 2010.

Public Art. More....

Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies

Public art installion. Projection system of real time spaces.

Visitors To A Gallery. 2004+

The audience as artwork. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Reader. 2015.

Data and art sculpture. More.....

Body Scan. Data Visulisation by Stanza

Portrait of the artist as system of machine learning.

The Reader. 2015.

Electronic sculpture. More....

Portrait of the artist as system of machine learning.

Public Squares. Re-Generation. 2010.

Privacy and alienation in the city. More....

Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Nemesis Machine. 2010-2019.

Connecting city spaces through data. More....

All artworks on this site by Stanza

Lost In Translation. 2015.

Machine learning and AI. More......

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Youth Culture. 2018.

A towering beautiful hooded sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Amorphoscapes. 2006.

Generative software systems. More.....

Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.

The Nemesis Machine. 2010-2019.

An ever evolving artwork, always different and always expanding. More....

Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies

The Reader. Data Sculture. 2015.

All the books ever read. More....

Digital artwork by Stanza

Portrait of the artist as system of machine learning.

Control Series. 1990.

Oil on Canvas. More...

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Youth Culture 2018.

A towering beautiful hooded sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Sensity. Data Cities. 2006-2009

Environental data art. More...

All artworks on this site by Stanza

Capacities. 2010.

Networked sculpture. More....

Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Third Space. 2012.

Mixed realies and landscapes. More

All artworks on this site by Stanza

Quantum Entanglement. 1996

Works on glass and mirror. More...

Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Panic Noise Series. 1985

Video art systems. More......

Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza

Youth Culture. 2018.

Sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Virus Codex. 2008.

Software systems. More....

All artworks on this site by Stanza

Parallel Realities. 2004 -2010

Time based sequqnctial artworks. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Nemesis Machine. 2010-2019.

Data scultpture. More....

A large installation adapted to each place where it is displayed that is a miniature city.

Endless Paths. 2006.

Software Generative Art-System. More...

Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza

The Panic Noise Series. 1985.

Video art systems. More...

Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza

The Nemesis Machine. 2010-2019.

Large installation. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.