Time based expression of global perpectives. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Video art systems. More..
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Electronic sculpture. More....
Portrait of the artist as system of machine learning.
Touch screen cities. More...
Private Collection
Data system of complicit surveillance. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data Sculpture. More....
Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Time based sequqnctial artworks. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Connecting city spaces through data. More...
All artworks on this site by Stanza
Mixing up data spaces. More....
Works On Canvas. All 100 cm by 100 cm and signed.
Sound art installation. More...
Installation
Installation plays thousands of sounds from around the world.
Generative softare art. More....
Custom hardware and complex software systems as art.
Networked city. More....
a large installation adapted to each place where it is displayed that is a miniature city.
Public Art. More....
Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Public art installion. Projection system of real time spaces.
Mixed realies and landscapes. More
All artworks on this site by Stanza
Data scultpture. More...
Hybrid digital sculpture.
Runs for 107 years ATCG. More...
Installation
Installation
Cells and viruses project.More....
Cells and viruses project, software system.
Using surveillance images to make time based art. More....
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
Systems of surveillance and control. More
The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza
networked city wide atwork. More.....
Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.
Installation of sound. More....
Data as sound installation.
Generative software systems. More.....
Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.
AI robots and public art.More...
Portait Of The Artist Stanza
Sounds installation. More...
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Interactive installation plays thousands of sounds from around the world.
Networked city. More...
a large installation adapted to each place where it is displayed.
A large installation adapted to each place where it is displayed
Public art and politics. More....
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Video art systems. More......
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
Artworks on mirror or perspex. More......
Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.
Complexity series. More....
Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza
Software systems. More....
All artworks on this site by Stanza
Large scale installation always different. More......
Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.
Privacy and alienation in the city. More....
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
More...
Installation for city wide public art. More....
Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
More
Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Time based system. More....
Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Video art systems. More...
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Sensors turn the invlsible world into sounds. More...
All artworks on this site by Stanza
Oil on Canvas. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Labyrinth exhibited on 15 touch screens. More....
labyrinth exhibited on 15 touch screens
Public art spectacle. More...
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Vison of all knowledge. More
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
DNA artworks. More
USing the artists DNA sequence.
ATCGTTCATAGTCCCATACCATTACCAATGGGATGATGTGATTAG
Environental data art. More...
All artworks on this site by Stanza
Invisible worlds of Sound. Installation More....
Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
The loss of privacy. More...
Stanza, netart, painting, networked space, installations.
Networked sculpture. More....
Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Large networked installation. More....
Available for exhibition.
Oil on Canvas. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
More....
The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
Large installation. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Software Generative Art-System. More...
Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza
More...
Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.
An ever evolving artwork, always different and always expanding. More....
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
All the books ever read. More....
Digital artwork by Stanza
Portrait of the artist as system of machine learning.
Most images show events captured from across the city.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Connecting space and visualising the landscape. More....
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Stars Of CCTV. More....
These images represent a portrait of England since the start of the CCTV imaging revolution. These CCTV artworks are re-mediated as history paintings and represent a social portrait of England. All Image available for exhibition.
Data Sculpture and AI. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Performance events about agency. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Video art systems. More.....
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Installation of neworked real-time data. More....
Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Installation
Data installation. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Installation adapted to each place where it is displayed
The data body as sculpture. More ...
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.
Self Portrait of the artist as system of information.
Connecting city spaces through data. More....
All artworks on this site by Stanza
Visitors To A Gallery. More...
Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Digtal Art More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Visitors are captured by the camera system in the gallery.
Machine learning and AI. More......
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Using custom made software and computer techniques. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Public art and politics.More.....
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Software system. More
Data Visualisation Computer,
DNA system time clock. More....
Stanza DNA as artwork installation.
The other side of experience. More....
The computer manipulates time experiences.
The networked body. More..
Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza
More...
The Agency At The End Of Civilisation.
Connected space. More...
Portrait Of Artist Stanza. All artworks on this site by Stanza
Installation of city based artworks. More....
Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Data scultpture. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Video art systems. More......
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Installation of networked intelligence. More....
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
An ever evolving artwork, always different and always expanding
Intelligent city. Evolving artwork. More
Intelligent city. Evolving artwork
Using environmental data to make art. More....
Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.
Interactive artwork. More....
Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Sound installtion. More
The Database Of Global Sound
Installation plays thousands of sounds from around the world.
Software System. More.....
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
Data scultpture. More....
A large installation adapted to each place where it is displayed that is a miniature city.
More....
All artworks on this site by Stanza
Experience of data cities. More....
Intelligent city. Evolving artwork The City as System
The audience as artwork. More..
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Live news feeds More...
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Digital generative artworks using information that bombards us online.
Time based digital artworks. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
A visual labyrinth. Installation of screens.More....
A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
About the perspectives of surveillance. More
A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza
Self Portrait of the artist as system of information.
Data scultpture. More...
Hybrid digital sculpture.
More......
All artworks on this site by Stanza
Data installation. More....
A large installation adapted to each place where it is displayed that is a miniature city.
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Real time experience. More.....
Stanza. Multiple surveillance cameras are accessed randomly in real time
Performance. More.....
Surveillance in Public Space
Data scultpture. More...
Hybrid digital sculpture.
Works on glass and mirror. More...
Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
More
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Analogies for the organic identity of the cityMore.....
The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
Data and art sculpture. More.....
Body Scan. Data Visulisation by Stanza
Portrait of the artist as system of machine learning.
More...
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
A digital art installation More....
The artists DNA as a building
>anipulating data and systems of surveillance into more systems of control.
- «
-
57
Parallel Reality. 2004-2010.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
91
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
-
112
Youth Culture 2018.
A large installation sculpture adapted to each place where it is displayed.
-
84
The Reader. 2015.
-
97
The Central City. 1997.
Private Collection
-
63
The Agency At The End Of Civilisation. 2014.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
09
The Reader. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
110
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
109
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
06
Parallel Realities. 2004 -2010
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
47
The Nemesis Machine. 2010
All artworks on this site by Stanza
-
94
The Third Space. 2012
Works On Canvas. All 100 cm by 100 cm and signed.
-
98
Herd Above The Noise.
Installation
-
32
Amorphoscapes. 2004.
Custom hardware and complex software systems as art.
-
100
The Nemesis Machine. 2010-2019.
a large installation adapted to each place where it is displayed that is a miniature city.
-
49
Data Data Data. 2010.
Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
76
The Third Space. 2012.
All artworks on this site by Stanza
-
101
The Reader. 2015.
Hybrid digital sculpture.
-
02
DNA CLOCK. 2005
Installation
-
95
Inference Cell. 2008.
Cells and viruses project, software system.
-
21
Parallel Reality Series II. 2004-2010.
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
-
81
The Agency At The End Of Civilisation. 2014
The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza
-
25
Urban Generation. 2004
Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.
-
26
Sonicity. 2010.
Data as sound installation.
-
19
Amorphoscapes. 2006.
Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.
-
96
Lost In Translation. 2015.
Portait Of The Artist Stanza
-
82
Herd Above The Noise. Ongoing.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
99
The Nemesis Machine. 2010-2019.
a large installation adapted to each place where it is displayed.
-
78
The Binary Graffiti Club
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
89
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
-
29
Quantum Entanglement. 1996
Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.
-
28
Surface Scars and Cuts. 2010.
Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza
-
50
Virus Codex. 2008.
All artworks on this site by Stanza
-
31
The Emergent City. At FOS 2019
Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.
-
66
Public Squares. Re-Generation. 2010.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
05
Soul Of The City. 2004.
Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
62
Parallel Reality. 2004-2010.
Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
11
Parallel Realities. 2004-2010.
Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
86
The Panic Noise Series. 1985.
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
44
Sonicity. Invisible Worlds of Data. 2010
All artworks on this site by Stanza
-
42
Control Series III. 1993.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
39
The Central City. 1997.
labyrinth exhibited on 15 touch screens
-
85
The Binary Graffiti Club 2019.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
22
Mind Map. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
90
Genomixer. Using the DNA sequence. 2004
USing the artists DNA sequence.
-
73
Sensity. Data Cities. 2006-2009
All artworks on this site by Stanza
-
07
Sonicity. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
75
You Are My Subjects. 2004.
Stanza, netart, painting, networked space, installations.
-
16
Capacities. 2010.
Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
52
The Nemesis Machine. 2010- 2019.
Available for exhibition.
-
54
Control Series. 1990.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
69
America Is Bleeding. 2005.
The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.
-
108
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
72
The Nemesis Machine. 2010-2019.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
14
Endless Paths. 2006.
Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza
-
43
Generative Artworks 2004.
Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.
-
15
The Nemesis Machine. 2010-2019.
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
36
The Reader. Data Sculture. 2015.
Digital artwork by Stanza
-
71
Urban Generation. 2004.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
48
Sensity. Data Cities. 2006- 2009
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
68
History Is Personal. 2008.
These images represent a portrait of England since the start of the CCTV imaging revolution. These CCTV artworks are re-mediated as history paintings and represent a social portrait of England. All Image available for exhibition.
-
13
The Reader. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
59
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
08
The Binary Graffiti Club.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
87
The Panic Noise Series. 1985.
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
01
The Nemesis Machine. The Emergent City. 2019.
Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
106
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
18
Body. (Self Portrait) 2012.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.
-
46
The Nemesis Machine. 2010-2019.
All artworks on this site by Stanza
-
61
Public Domain. 2008.
Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
12
Visitors To A Gallery: Referential Self. 2004 +
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
20
Lost In Translation. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
53
Parallel Reality. 2004-2010.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
83
The Binary Graffiti Club. 2015.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
55
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
93
Syncronicity: Infinite Possibilities.
Data Visualisation Computer,
-
10
DNA CLOCK. 2005.
Stanza DNA as artwork installation.
-
70
Fortuna. 2010
The computer manipulates time experiences.
-
80
Body 1010101. 2012.
Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza
-
77
The Agency At The End Of Civilisation. 2014.
The Agency At The End Of Civilisation.
-
79
Entropy Through Black Matter. 2014.
Portrait Of Artist Stanza. All artworks on this site by Stanza
-
51
The Central City. 1997.
Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
105
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
88
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
111
Youth Culture 2018.
A large installation sculpture adapted to each place where it is displayed.
-
03
The Nemesis Machine. 2010-2019.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
38
The Nemesis Machine. 2010-2017.
Intelligent city. Evolving artwork
-
27
Capacities. 2010.
Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.
-
64
Soul of The City. 2004.
Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
92
Herd Above The Noise.
The Database Of Global Sound
-
23
Parallel Reality. 2004
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
-
104
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
34
The Emergent City at FOS 2019
All artworks on this site by Stanza
-
37
The Nemesis Machine. 2010-2017.
Intelligent city. Evolving artwork The City as System
-
58
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
65
All Tomorrows Stories. 2002.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
45
Parallel Reality. 2004-2010
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
40
Agency at The End Of Civilisation. 2014.
A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
-
30
Body. 0100001001101111011001. 2014
A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza
-
102
The Reader. 2015.
Hybrid digital sculpture.
-
67
The Nemesis Machine. 2010-2019.
All artworks on this site by Stanza
-
107
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
56
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
113
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
17
Urban Generation. 2004
Stanza. Multiple surveillance cameras are accessed randomly in real time
-
35
We Have Nothing To Hide. 2010.
Surveillance in Public Space
-
103
The Reader. 2015.
Hybrid digital sculpture.
-
24
Quantum Entanglement. 1996
Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
74
Sonicity. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
41
Networks In The Emergent City. 2010
The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
-
33
The Reader. 2015.
Body Scan. Data Visulisation by Stanza
-
60
Sonicity. Invisibe Worlds. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
04
Agency at The End Of Civilisation. 2014.
The artists DNA as a building
- »
- Pause
Frontpage Slideshow (standalone) | Copyright © 2006-2011 JoomlaWorks Ltd.
Welcome: This website shows only artwork made by Steve Tanza; please enjoy. Stanza is a practising artist, based in London. These artworks include installations, public art, generative data, paintings, prints and netart. Artwork has been exhibited at the Venice Biennale, Bruges Museum and the Victoria and Albert Museum. He is the recipient of a Nesta Dreamtime Award, an AHRC creative fellowship and twenty four international art prizes and awards. All artwork on this site is made between 1982 and 2021.
Main projects include: The Emergent City, visual artworks informed by idea the city is system of data. Genomixer artworks are made using the artist's DNA sequence. Soundcities an online database and installation of thousands of field recordings from around the world. Sensity collects visualises the city of environmental data as a living system. Urban Generation incorporates surveillance feeds to make an generative artwork. Visitors to A Gallery and Public Domain uses gallery visitors inside a surveillance system.
Selected Exhibitions: Bruges Museum: La Biennale di Venezia ie Venice Biennale: Victoria Albert Museum: Tate Britain: Mundo Urbano Madrid: State Museum, Novorsibirsk: Centre des Arts d'Enghien-les-Bains France: Museo Tamayo Arte Contemporáneo Mexico: Plymouth Arts Centre: ICA London: Sao Paulo Biennale: Trøndelag Senter for Samtidskunst Norway: Pace Digital USA:
Recent News: 1 Soundcities gets an update. 2 London Lockdown New Artworks. 3 COVID tracking app. Surveillance and control .4 Salisbury Cathedral celebrates 800 years with art exhibition. 5 STARTS Residencies Days Private Opening. 6 The Emergent City presented at Goodwood Festival of Speed. 7 Youth Culture sculpture at The Lowry.
Commissions, and exhibition requests. All work is for sale, inquiries welcome. EMAIL [stanza@sublime.net] All artwork © Stanza 1982- 2021.
Keywords. Art, surveillance, data, city, networked art, installations.
|
|
|
|