Youth Culture. 2018.

Youth Culture. 2018.

Sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

The Binary Graffiti Club

The Binary Graffiti Club

Public art and politics. More....

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

The Nemesis Machine. Takeover. 2022 Version

The Nemesis Machine. Takeover. 2022 Version

Installation. More

A large installation adapted to each place where it is displayed that is a miniature city.

Incorporating data ownership, surveillance, real time urban environments

Parallel Realities. 2004 -2010

Parallel Realities. 2004 -2010

Time based sequential artworks. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices.

Living Landscapes Series

Living Landscapes Series

Data paintings with AI and WIFI. More....

Selected artwork uses Artificial Intelligence (AI) and Machine Learning (ML) to investigate global pollution data.

We Have Nothing To Hide. 2010.

We Have Nothing To Hide. 2010.

Performance. More.....

Surveillance in Public Space

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

Networked city. More...

a large installation adapted to each place where it is displayed.

A large installation adapted to each place where it is displayed

Capacities. 2010.

Capacities. 2010.

Using environmental data to make art. More....

Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.

Living Systems 2023

Living Systems 2023

Installation. More

Invisible Landscape: Germany. A dynamic generative artwork using transport, weather, pollution data

The neural network creates patterns inside patterns of data to reform the invisible across the whole of the country.

The Reader. 2015.

The Reader. 2015.

Data Sculpture and AI. More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Networks In The Emergent City. 2010

Networks In The Emergent City. 2010

Analogies for the organic identity of the cityMore.....

The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza

Youth Culture 2018.

Youth Culture 2018.

A towering beautiful hooded sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Velocity 2019- 2023

Velocity 2019- 2023

Installation. More

This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .

The artwork becomes an interwoven and entangled universe that has no borders.

Sonicity. 2010.

Sonicity. 2010.

Invisible worlds of Sound. Installation More....

Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city.

Youth Culture. 2018.

Youth Culture. 2018.

A towering beautiful hooded sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

The Binary Graffiti Club. 2015.

The Binary Graffiti Club. 2015.

Public art and politics.More.....

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

Connecting city spaces through data. More....

All artworks on this site by Stanza

The Reader. 2015.

The Reader. 2015.

Data scultpture. More...

Hybrid digital sculpture.

The Central City. 1997.

The Central City. 1997.

Touch screen cities. More...

Private Collection

The Nemesis Machine. Manifestation 2023

The Nemesis Machine. Manifestation 2023

Data AI Installation

The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).

The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).

More...
DNA CLOCK. 2005

DNA CLOCK. 2005

Runs for 107 years ATCG. More...

Installation

Installation

Control Series. 1990.

Control Series. 1990.

Oil on Canvas. More...

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Nemesis Machine. The Emergent City.  2019.

The Nemesis Machine. The Emergent City. 2019.

Installation of neworked real-time data. More....

Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Installation

The Reader. Data Sculture. 2015.

The Reader. Data Sculture. 2015.

All the books ever read. More....

Digital artwork by Stanza

Portrait of the artist as system of machine learning.

Soul Of The City. 2004.

Soul Of The City. 2004.

Installation for city wide public art. More....

Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

Data installation. More....

A large installation adapted to each place where it is displayed that is a miniature city.

Installation adapted to each place where it is displayed

The Third Space. 2012.

The Third Space. 2012.

Mixed realies and landscapes. More

All artworks on this site by Stanza

The Third Space. 2012

The Third Space. 2012

Mixing up data spaces. More....

Works On Canvas. All 100 cm by 100 cm and signed.

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

Installation of networked intelligence. More....

Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

An ever evolving artwork, always different and always expanding

Sensity. Data Cities. 2006-2009

Sensity. Data Cities. 2006-2009

Environental data art. More...

All artworks on this site by Stanza

The Nemesis Machine. 2010-2017.

The Nemesis Machine. 2010-2017.

Intelligent city. Evolving artwork. More

Intelligent city. Evolving artwork

The Binary Graffiti Club.

The Binary Graffiti Club.

Performance events about agency. More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. All artworks on this site by Stanza

The Panic Noise Series. 1985

The Panic Noise Series. 1985

Video art systems. More..

Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza

DNA CLOCK. 2005.

DNA CLOCK. 2005.

DNA system time clock. More....

Stanza DNA as artwork installation.

Entropy Through Black Matter. 2014.

Entropy Through Black Matter. 2014.

Connected space. More...

Portrait Of Artist Stanza. All artworks on this site by Stanza

Sonicity. 2010.

Sonicity. 2010.

Installation of sound. More....

Data as sound installation.

Youth Culture. 2018.

Youth Culture. 2018.

Sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

Public Domain. 2008.

Public Domain. 2008.

Visitors To A Gallery. More...

Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Agency at The End Of Civilisation. 2014.

Agency at The End Of Civilisation. 2014.

A visual labyrinth. Installation of screens.More....

A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza

Visitors To A Gallery: Referential Self. 2004 +

Visitors To A Gallery: Referential Self. 2004 +

Digtal Art More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Visitors are captured by the camera system in the gallery.

Visitors To A Gallery. 2004+

Visitors To A Gallery. 2004+

The audience as artwork. More..

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

An ever evolving artwork, always different and always expanding. More....

Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies

Quantum Entanglement. 1996

Quantum Entanglement. 1996

Works on glass and mirror. More...

Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Parallel Reality. 2004-2010.

Parallel Reality. 2004-2010.

More

Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Lost In Translation. 2015.

Lost In Translation. 2015.

AI robots and public art.More...

Portait Of The Artist Stanza

The Emergent City at FOS 2019

The Emergent City at FOS 2019

More....

All artworks on this site by Stanza

Visitors To A Gallery. 2004+

Visitors To A Gallery. 2004+

The audience as artwork. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

More......

All artworks on this site by Stanza

Velocity 2019- 2023

Velocity 2019- 2023

Installation. More

This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .

The artwork becomes an interwoven and entangled universe that has no borders.

The Agency At The End Of Civilisation. 2014

The Agency At The End Of Civilisation. 2014

Systems of surveillance and control. More

The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza

Herd Above The Noise.

Herd Above The Noise.

Sound art installation. More...

Installation

Installation plays thousands of sounds from around the world.

The Nemesis Machine. 2010

The Nemesis Machine. 2010

Connecting city spaces through data. More...

All artworks on this site by Stanza

Urban Generation. 2002.

Urban Generation. 2002.

Most images show events captured from across the city.

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Panic Noise Series. 1985

The Panic Noise Series. 1985

Video art systems. More......

Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza

Living Landscapes. 2018+

Living Landscapes. 2018+

Data Paintings and AI. More

Making The invibile visible

Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?

Mind Map. 2015.

Mind Map. 2015.

Vison of all knowledge. More

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Nemesis Machine. Manifestation 2023.

The Nemesis Machine. Manifestation 2023.

Data installation. More....

A large installation adapted to each place where it is displayed that is a miniature city.

Parallel Reality. 2004-2010.

Parallel Reality. 2004-2010.

Time based expression of global perpectives. More...

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Parallel Reality Series II. 2004-2010.

Parallel Reality Series II. 2004-2010.

Using surveillance images to make time based art. More....

Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.

Velocity 2019- 2023

Velocity 2019- 2023

Installation. More

This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .

The artwork becomes a real-time collective performance and the technology highlights how separate and stacked informational layers can be threaded to be made visible as an interwoven and entangled universe that has no borders.

Endless Paths. 2006.

Endless Paths. 2006.

Software Generative Art-System. More...

Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza

America Is Bleeding. 2005.

America Is Bleeding. 2005.

More....

The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.

Visitors To A Gallery. 2004+

Visitors To A Gallery. 2004+

The audience as artwork. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Data Data Data. 2010.

Data Data Data. 2010.

Public Art. More....

Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies

Public art installion. Projection system of real time spaces.

Syncronicity: Infinite Possibilities.

Syncronicity: Infinite Possibilities.

Software system. More

Data Visualisation Computer,

All Tomorrows Stories. 2002.

All Tomorrows Stories. 2002.

Live news feeds More...

Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Digital generative artworks using information that bombards us online.

Body. 0100001001101111011001. 2014

Body. 0100001001101111011001. 2014

About the perspectives of surveillance. More

A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza

Self Portrait of the artist as system of information.

The Binary Graffiti Club 2019.

The Binary Graffiti Club 2019.

Public art spectacle. More...

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

The Nemesis Machine. Manifestation 2023

The Nemesis Machine. Manifestation 2023

Networked city. More....

a large installation adapted to each place where it is displayed

The Panic Noise Series. 1985

The Panic Noise Series. 1985

Video art systems. More......

Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza

Parallel Reality. 2004-2010.

Parallel Reality. 2004-2010.

Using custom made software and computer techniques. More...

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Fortuna. 2010

Fortuna. 2010

The other side of experience. More....

The computer manipulates time experiences.

The Nemesis Machine. 2010-2017.

The Nemesis Machine. 2010-2017.

Experience of data cities. More....

Intelligent city. Evolving artwork The City as System

The Agency At The End Of Civilisation. 2014.

The Agency At The End Of Civilisation. 2014.

Data system of complicit surveillance. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Sonicity. Invisibe Worlds. 2010.

Sonicity. Invisibe Worlds. 2010.

More...

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

The Nemesis Machine. Manifestation 2023

The Nemesis Machine. Manifestation 2023

Networked city. More....

a large installation adapted to each place where it is displayed that is a miniature city.

Control Series III. 1993.

Control Series III. 1993.

Oil on Canvas. More....

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Youth Culture 2018.

Youth Culture 2018.

A towering beautiful hooded sculpture. More

A large installation sculpture adapted to each place where it is displayed.

The sculpture is a hybrid steel structure with custom electronics.

The Central City. 1997.

The Central City. 1997.

Installation of city based artworks. More....

Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Parallel Reality. 2004

Parallel Reality. 2004

Software System. More.....

Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.

I Am Alive.2023 .

I Am Alive.2023 .

AI paintings More....

Ai and data artwork available for exhibition.

Sonicity. 2010.

Sonicity. 2010.

More

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Living Landscapes. 2018+

Living Landscapes. 2018+

Data Paintings and AI. More

Making The invibile visible

Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?

The Nemesis Machine. 2010- 2019.

The Nemesis Machine. 2010- 2019.

Large networked installation. More....

Available for exhibition.

Lost In Translation. 2015.

Lost In Translation. 2015.

Machine learning and AI. More......

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Sensity. Data Cities. 2006- 2009

Sensity. Data Cities. 2006- 2009

Connecting space and visualising the landscape. More....

Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies

Agency at The End Of Civilisation. 2014.

Agency at The End Of Civilisation. 2014.

A digital art installation More....

The artists DNA as a building

>anipulating data and systems of surveillance into more systems of control.

The Panic Noise Series. 1985.

The Panic Noise Series. 1985.

Video art systems. More.....

Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza

Living Landscapes. 2018+

Living Landscapes. 2018+

Data Paintings and AI. More

Making The invibile visible

Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?

Capacities. 2010.

Capacities. 2010.

Networked sculpture. More....

Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Genomixer. Using the DNA sequence. 2004

Genomixer. Using the DNA sequence. 2004

DNA artworks. More

USing the artists DNA sequence.

ATCGTTCATAGTCCCATACCATTACCAATGGGATGATGTGATTAG

Generative Artworks 2004.

Generative Artworks 2004.

More...

Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.

Parallel Reality. 2004-2010

Parallel Reality. 2004-2010

Time based digital artworks. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

The Panic Noise Series. 1985.

The Panic Noise Series. 1985.

Video art systems. More...

Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza

The Nemesis Machine. 2010-2019.

The Nemesis Machine. 2010-2019.

Data scultpture. More....

A large installation adapted to each place where it is displayed that is a miniature city.

The Central City. 1997.

The Central City. 1997.

Labyrinth exhibited on 15 touch screens. More....

labyrinth exhibited on 15 touch screens

Body 1010101.  2012.

Body 1010101. 2012.

The networked body. More..

Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza

Virus Codex. 2008.

Virus Codex. 2008.

Software systems. More....

All artworks on this site by Stanza

Visitors To A Gallery. 2004+

Visitors To A Gallery. 2004+

The audience as artwork. More....

Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.

Amorphoscapes. 2006.

Amorphoscapes. 2006.

Generative software systems. More.....

Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.

Sonicity. Invisible Worlds of Data. 2010

Sonicity. Invisible Worlds of Data. 2010

Sensors turn the invlsible world into sounds. More...

All artworks on this site by Stanza

Herd Above The Noise.

Herd Above The Noise.

Sound installtion. More

The Database Of Global Sound

Installation plays thousands of sounds from around the world.

Body. (Self Portrait) 2012.

Body. (Self Portrait) 2012.

The data body as sculpture. More ...

Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.

Self Portrait of the artist as system of information.

The Nemesis Machine. Manifestation

The Nemesis Machine. Manifestation

Installation. More

A large installation adapted to each place where it is displayed that is a miniature city.

Incorporating data ownership, surveillance, real time urban environments

Amorphoscapes. 2004.

Amorphoscapes. 2004.

Generative softare art. More....

Custom hardware and complex software systems as art.

Urban Generation. 2002

Urban Generation. 2002

networked city wide atwork. More.....

Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.

Soul of The City. 2004.

Soul of The City. 2004.

Interactive artwork. More....

Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Surface Scars and Cuts. 2010.

Surface Scars and Cuts. 2010.

Complexity series. More....

Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza

You Are My Subjects. 2004.

You Are My Subjects. 2004.

The loss of privacy. More...

Stanza, netart, painting, networked space, installations.

Herd Above The Noise. Ongoing.

Herd Above The Noise. Ongoing.

Sounds installation. More...

Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza

Interactive installation plays thousands of sounds from around the world.

The Reader. 2015.

The Reader. 2015.

Data scultpture. More...

Hybrid digital sculpture.

The Emergent City. At FOS 2019

The Emergent City. At FOS 2019

Large scale installation always different. More......

Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.

The Agency At The End Of Civilisation. 2014.

The Agency At The End Of Civilisation. 2014.

More...

The Agency At The End Of Civilisation.

The Nemesis Machine. Takeover. 2022 Version

The Nemesis Machine. Takeover. 2022 Version

Installation. More

A large installation adapted to each place where it is displayed that is a miniature city.

Incorporating data ownership, surveillance, real time urban environments

Public Squares. Re-Generation. 2010.

Public Squares. Re-Generation. 2010.

Privacy and alienation in the city. More....

Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

More...
Quantum Entanglement. 1996

Quantum Entanglement. 1996

Artworks on mirror or perspex. More......

Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.

Inference Cell. 2008.

Inference Cell. 2008.

Cells and viruses project.More....

Cells and viruses project, software system.

The Reader. 2015.

The Reader. 2015.

Data scultpture. More...

Hybrid digital sculpture.

Running Out Of Time. 2023

Running Out Of Time. 2023

Installation. More

Two gold towers react to pollution data from 120 global cities.

An eco visualisation that questions the reality of how we are polluting our cities and our environment.

The Reader. 2015.

The Reader. 2015.

Data and art sculpture. More.....

Body Scan. Data Visulisation by Stanza

Portrait of the artist as system of machine learning.

The Reader. 2015.

The Reader. 2015.

Electronic sculpture. More....

Portrait of the artist as system of machine learning.

The Reader. 2015.

The Reader. 2015.

Data Sculpture. More....

Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Urban Generation. 2002

Urban Generation. 2002

Real time data experience. More.....

Multiple surveillance cameras are accessed randomly in real time

Parallel Realities. 2004-2010.

Parallel Realities. 2004-2010.

Time based system. More....

Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza

Frontpage Slideshow (standalone) | Copyright © 2006-2011 JoomlaWorks Ltd.

analysing thousands of city-wide data inputs to make predictive outputs using machine learning (AI) analysing thousands of city-wide data inputs to make predictive outputs using machine learning (AI) analysing thousands of city-wide data inputs to make predictive outputs using machine learning (AI)
Nemesis Machine at HNF AI artworks and live data feeds. Living Landscapes
analysing thousands of city-wide data inputs to make predictive outputs using machine learning (AI) Runing Out Of Time at HNF People tracking app
Steve Tanza Thin Air at HNF A large scale interactive art installation
A large scale interactive art installation youth culture stanza Out Of Breath
The Binary Graffiti Club.The choir sings the binary messages Steve Tanza stanza the reader

Tobots make drawings
youth culture Stanza nemesis machine
Artworks made of surveillance images by Steve Tanza

stanza sensity sensing the city. The Internet of things and smart city artwork.

Steve Tanza , Stanza Live CCTV artwork. Publicity II

Surveillance art project Surveillance based artwork Generative paintings.
Mapos and cities by Steve Tanza Speakers to make art. The Ssound of trees.
Steve Tanza Data art by Steve Tanza Stanza surveillance artwork.
Surveillance art project Using DNA to make art. Data art. Stanza.
Artwork using the artist's dna. Generative paintings. Generative artworks.
The Central City. Stance, Steve Tanza

Welcome: This website shows only artwork made by Stanza; please enjoy. These artworks include installations, public art, generative data, paintings, prints and netart. He is the recipient of twenty five international art prizes and awards. All artwork on this site is made between 1981 and 2026.

News: Winner of Next Nature Prize Eindhoven. Research residency at Diriyah Art Futures Riyadh and STARTS EU arts residency at MEET Milano for my AI work about cities and entanglement. Recent solo exhibitions at Deutsches Museum Nuremberg, Samek Art Museum USA, Heinz Nixdorf Museum Germany, and Jarvenpaa Art Museum Finland. Living Landscapes series of AI and Machine learning systems with global data from my API is upcoming in mysolo show at Metamorf Tondheim Norwayy, Stanza music performance live with Soundcities soundscapes project in Enschede and in Rotterdam. Velocity the new AI machine learning tracking app released and exhibited in three art galleries simultaneously.

Main projects include: The Emergent City, visual artworks informed by idea the city is system of data. Genomixer artworks are made using the artist's DNA sequence. Soundcities an online database and installation of thousands of field recordings from around the world. Sensity visualises the city of environmental data as a living system. Urban Generation incorporates surveillance feeds to make a generative artwork. Visitors to A Gallery and Public Domain uses gallery visitors inside a surveillance system.

Commissions, and exhibition requests welcome. All work is for sale, inquiries via Email: studio@stanza.co.uk

--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Video channel portfolios.

These areas document various net at, software systems, AI data paintings and installationsas videos.
Entangled Cities NET ART by STANZA. PANIC NOISE
AMORPHOSCAPES BY STANZA INSTALLATIONS BY STANZA Generative art and code.

All artwork © Stanza [Steve Tanza] 1982- 2026.

INSTAGRAM @ stanza_dna

FACEBOOK @ stanza.dna