Live news feeds More...
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Digital generative artworks using information that bombards us online.
Labyrinth exhibited on 15 touch screens. More....
labyrinth exhibited on 15 touch screens
Large scale installation always different. More......
Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.
Installation. More
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
The artwork becomes an interwoven and entangled universe that has no borders.
DNA system time clock. More....
Stanza DNA as artwork installation.
Time based digital artworks. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Public art and politics.More.....
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
DNA artworks. More
USing the artists DNA sequence.
ATCGTTCATAGTCCCATACCATTACCAATGGGATGATGTGATTAG
Data paintings with AI and WIFI. More....
Selected artwork uses Artificial Intelligence (AI) and Machine Learning (ML) to investigate global pollution data.
Installation of city based artworks. More....
Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Systems of surveillance and control. More
The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza
More....
All artworks on this site by Stanza
Digtal Art More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Visitors are captured by the camera system in the gallery.
A digital art installation More....
The artists DNA as a building
>anipulating data and systems of surveillance into more systems of control.
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
Software system. More
Data Visualisation Computer,
More...
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Mixed realies and landscapes. More
All artworks on this site by Stanza
Public art spectacle. More...
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Environental data art. More...
All artworks on this site by Stanza
Machine learning and AI. More......
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Complexity series. More....
Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza
More....
The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.
The data body as sculpture. More ...
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.
Self Portrait of the artist as system of information.
Installation of sound. More....
Data as sound installation.
Runs for 107 years ATCG. More...
Installation
Installation
Real time data experience. More.....
Multiple surveillance cameras are accessed randomly in real time
Large networked installation. More....
Available for exhibition.
networked city wide atwork. More.....
Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.
Connecting space and visualising the landscape. More....
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Generative software systems. More.....
Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.
Installation. More
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
The artwork becomes an interwoven and entangled universe that has no borders.
Using environmental data to make art. More....
Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.
Oil on Canvas. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Data Paintings and AI. More
Making The invibile visible
Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?
Performance events about agency. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. All artworks on this site by Stanza
Data and art sculpture. More.....
Body Scan. Data Visulisation by Stanza
Portrait of the artist as system of machine learning.
Video art systems. More..
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
More
Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Cells and viruses project.More....
Cells and viruses project, software system.
Connecting city spaces through data. More....
All artworks on this site by Stanza
Privacy and alienation in the city. More....
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
More...
Data AI Installation
The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).
The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).
More...
Vison of all knowledge. More
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Public Art. More....
Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Public art installion. Projection system of real time spaces.
Data Paintings and AI. More
Making The invibile visible
Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?
Data installation. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Installation adapted to each place where it is displayed
Sound installtion. More
The Database Of Global Sound
Installation plays thousands of sounds from around the world.
Data scultpture. More...
Hybrid digital sculpture.
The networked body. More..
Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza
Data scultpture. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Using surveillance images to make time based art. More....
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
Networked city. More...
a large installation adapted to each place where it is displayed.
A large installation adapted to each place where it is displayed
Time based sequential artworks. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices.
Video art systems. More......
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
Data scultpture. More...
Hybrid digital sculpture.
Connected space. More...
Portrait Of Artist Stanza. All artworks on this site by Stanza
Connecting city spaces through data. More...
All artworks on this site by Stanza
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data scultpture. More...
Hybrid digital sculpture.
A visual labyrinth. Installation of screens.More....
A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
Most images show events captured from across the city.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Installation. More
Two gold towers react to pollution data from 120 global cities.
An eco visualisation that questions the reality of how we are polluting our cities and our environment.
Installation for city wide public art. More....
Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Software System. More.....
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
Networked city. More....
a large installation adapted to each place where it is displayed that is a miniature city.
Public art and politics. More....
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Sounds installation. More...
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
Interactive installation plays thousands of sounds from around the world.
Performance. More.....
Surveillance in Public Space
Electronic sculpture. More....
Portrait of the artist as system of machine learning.
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
Artworks on mirror or perspex. More......
Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.
Touch screen cities. More...
Private Collection
Time based expression of global perpectives. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data system of complicit surveillance. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data installation. More....
A large installation adapted to each place where it is displayed that is a miniature city.
Data Paintings and AI. More
Making The invibile visible
Who owns the data, who does this space belong to? What is the future of this technologically stacked interlocking mediated environment?
Interactive artwork. More....
Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Sensors turn the invlsible world into sounds. More...
All artworks on this site by Stanza
Networked sculpture. More....
Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Data Sculpture. More....
Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Visitors To A Gallery. More...
Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Installation of neworked real-time data. More....
Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Installation
Analogies for the organic identity of the cityMore.....
The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
More...
The Agency At The End Of Civilisation.
Works on glass and mirror. More...
Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Intelligent city. Evolving artwork. More
Intelligent city. Evolving artwork
Software Generative Art-System. More...
Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza
Video art systems. More......
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Mixing up data spaces. More....
Works On Canvas. All 100 cm by 100 cm and signed.
Installation. More
Invisible Landscape: Germany. A dynamic generative artwork using transport, weather, pollution data
The neural network creates patterns inside patterns of data to reform the invisible across the whole of the country.
The audience as artwork. More..
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
Installation. More
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
The artwork becomes a real-time collective performance and the technology highlights how separate and stacked informational layers can be threaded to be made visible as an interwoven and entangled universe that has no borders.
Installation. More
A large installation adapted to each place where it is displayed that is a miniature city.
Incorporating data ownership, surveillance, real time urban environments
Oil on Canvas. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
All the books ever read. More....
Digital artwork by Stanza
Portrait of the artist as system of machine learning.
More......
All artworks on this site by Stanza
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Time based system. More....
Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Data Sculpture and AI. More....
Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
The audience as artwork. More....
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
More
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
Generative softare art. More....
Custom hardware and complex software systems as art.
Networked city. More....
a large installation adapted to each place where it is displayed
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
About the perspectives of surveillance. More
A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza
Self Portrait of the artist as system of information.
An ever evolving artwork, always different and always expanding. More....
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
Software systems. More....
All artworks on this site by Stanza
Using custom made software and computer techniques. More...
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
The loss of privacy. More...
Stanza, netart, painting, networked space, installations.
AI paintings More....
Ai and data artwork available for exhibition.
Sound art installation. More...
Installation
Installation plays thousands of sounds from around the world.
Video art systems. More...
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Invisible worlds of Sound. Installation More....
Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city.
Video art systems. More.....
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
Experience of data cities. More....
Intelligent city. Evolving artwork The City as System
AI robots and public art.More...
Portait Of The Artist Stanza
The other side of experience. More....
The computer manipulates time experiences.
More...
Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.
A towering beautiful hooded sculpture. More
A large installation sculpture adapted to each place where it is displayed.
The sculpture is a hybrid steel structure with custom electronics.
Installation of networked intelligence. More....
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
An ever evolving artwork, always different and always expanding
- «
-
65
All Tomorrows Stories. 2002.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
39
The Central City. 1997.
labyrinth exhibited on 15 touch screens
-
31
The Emergent City. At FOS 2019
Stanza's project which has won the Nova Folkets Hus facade international juried competition in 2010 is dynamic facade, mirroring the dynamic activities taking place within the building.
-
122
Velocity 2019- 2023
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
-
10
DNA CLOCK. 2005.
Stanza DNA as artwork installation.
-
45
Parallel Reality. 2004-2010
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
83
The Binary Graffiti Club. 2015.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
90
Genomixer. Using the DNA sequence. 2004
USing the artists DNA sequence.
-
104
Living Landscapes Series
Selected artwork uses Artificial Intelligence (AI) and Machine Learning (ML) to investigate global pollution data.
-
51
The Central City. 1997.
Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
81
The Agency At The End Of Civilisation. 2014
The Agency At The End Of Civilisation.The artworks makes use of future predictive software while at the same time exploring time from multiple perspectives in what Stanza calls a Parallel Reality. All artworks on this site by Stanza
-
34
The Emergent City at FOS 2019
All artworks on this site by Stanza
-
12
Visitors To A Gallery: Referential Self. 2004 +
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
04
Agency at The End Of Civilisation. 2014.
The artists DNA as a building
-
117
The Nemesis Machine. Takeover. 2022 Version
A large installation adapted to each place where it is displayed that is a miniature city.
-
93
Syncronicity: Infinite Possibilities.
Data Visualisation Computer,
-
60
Sonicity. Invisibe Worlds. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
76
The Third Space. 2012.
All artworks on this site by Stanza
-
85
The Binary Graffiti Club 2019.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
73
Sensity. Data Cities. 2006-2009
All artworks on this site by Stanza
-
20
Lost In Translation. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
28
Surface Scars and Cuts. 2010.
Art maps as the drawings and pattern that we make and leave behind on the landscape All artworks on this site by Stanza
-
69
America Is Bleeding. 2005.
The computer manipulates real time experiences and life of NYC as it unfolds. The city and its population are all actors in this real time play. All Image available for exhibition.
-
18
Body. (Self Portrait) 2012.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes.
-
26
Sonicity. 2010.
Data as sound installation.
-
02
DNA CLOCK. 2005
Installation
-
17
Urban Generation. 2002
Multiple surveillance cameras are accessed randomly in real time
-
52
The Nemesis Machine. 2010- 2019.
Available for exhibition.
-
25
Urban Generation. 2002
Stanza. Multiple CCTV cameras are accessed randomly in real time to make this urban tapestry. What you see is an evolving, generative artwork. These images are from taken London, and they happen as you see them, in real time.
-
48
Sensity. Data Cities. 2006- 2009
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
19
Amorphoscapes. 2006.
Stanza. This series of artworks is about exploring the artistic process, being transparent about the process and the development and production of new work and doing it all in public in the gallery.
-
123
Velocity 2019- 2023
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
-
27
Capacities. 2010.
Life In The Emergent City .Using environmental data to make art. The data is the medium of the age.
-
42
Control Series III. 1993.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
116
Living Landscapes. 2018+
Making The invibile visible
-
08
The Binary Graffiti Club.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. All artworks on this site by Stanza
-
33
The Reader. 2015.
Body Scan. Data Visulisation by Stanza
-
91
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
-
62
Parallel Reality. 2004-2010.
Artworks about surveillance, and the ethics of the control spac. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
110
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
95
Inference Cell. 2008.
Cells and viruses project, software system.
-
46
The Nemesis Machine. 2010-2019.
All artworks on this site by Stanza
-
66
Public Squares. Re-Generation. 2010.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
68
The Nemesis Machine. Manifestation 2023
The installation uses thousands of real-time data streams which are being processed by unsupervised machine learning (AI).
-
22
Mind Map. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
49
Data Data Data. 2010.
Visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
114
Living Landscapes. 2018+
Making The invibile visible
-
106
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
92
Herd Above The Noise.
The Database Of Global Sound
-
103
The Reader. 2015.
Hybrid digital sculpture.
-
80
Body 1010101. 2012.
Real-time environmental data is embodied in Stanzas life-size sculpture assembled from computer components and acrylic slices of his own physique. All artworks on this site by Stanza
-
105
The Nemesis Machine. 2010-2019.
A large installation adapted to each place where it is displayed that is a miniature city.
-
21
Parallel Reality Series II. 2004-2010.
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
-
99
The Nemesis Machine. 2010-2019.
a large installation adapted to each place where it is displayed.
-
06
Parallel Realities. 2004 -2010
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices.
-
89
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1987. All artworks on this site by Stanza
-
101
The Reader. 2015.
Hybrid digital sculpture.
-
79
Entropy Through Black Matter. 2014.
Portrait Of Artist Stanza. All artworks on this site by Stanza
-
47
The Nemesis Machine. 2010
All artworks on this site by Stanza
-
56
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
102
The Reader. 2015.
Hybrid digital sculpture.
-
40
Agency at The End Of Civilisation. 2014.
A visual labyrinth, a maze of circumstance. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
-
71
Urban Generation. 2002.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
119
Running Out Of Time. 2023
Two gold towers react to pollution data from 120 global cities.
-
05
Soul Of The City. 2004.
Stanza, netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
23
Parallel Reality. 2004
Stanza. These artworks are made from thousands of live real time CCTV images using custom made software which captures the images over selected periods of time.
-
100
The Nemesis Machine. Manifestation 2023
a large installation adapted to each place where it is displayed that is a miniature city.
-
78
The Binary Graffiti Club
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
82
Herd Above The Noise. Ongoing.
Inspiring young people to see the city as canvas to create change. All artworks on this site by Stanza
-
35
We Have Nothing To Hide. 2010.
Surveillance in Public Space
-
84
The Reader. 2015.
-
118
The Nemesis Machine. Takeover. 2022 Version
A large installation adapted to each place where it is displayed that is a miniature city.
-
29
Quantum Entanglement. 1996
Artworks on mirror or perspex about the urban landscape, surveillance culture, privacy and alienation in the city.
-
97
The Central City. 1997.
Private Collection
-
57
Parallel Reality. 2004-2010.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
63
The Agency At The End Of Civilisation. 2014.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
107
The Nemesis Machine. Manifestation 2023.
A large installation adapted to each place where it is displayed that is a miniature city.
-
115
Living Landscapes. 2018+
Making The invibile visible
-
64
Soul of The City. 2004.
Soul uses camera networks and environmemental data from sensors to re-imagine privacy and alienation in the city. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
44
Sonicity. Invisible Worlds of Data. 2010
All artworks on this site by Stanza
-
16
Capacities. 2010.
Life In The Emergent City. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
55
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
09
The Reader. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
61
Public Domain. 2008.
Visitors are units of data, moving around the giant database the gallery. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
01
The Nemesis Machine. The Emergent City. 2019.
Stanza netart, Steve Tanza, paintings, networked space, installations, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
41
Networks In The Emergent City. 2010
The city itself is always changing; it is always in flux. The idea is to go deeper into analogies for the organic identity of the city.. All artworks on this site by Stanza
-
77
The Agency At The End Of Civilisation. 2014.
The Agency At The End Of Civilisation.
-
24
Quantum Entanglement. 1996
Stanza artwork has been shown at The Venice Biennale, Tate Britain, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
38
The Nemesis Machine. 2010-2017.
Intelligent city. Evolving artwork
-
14
Endless Paths. 2006.
Stanza is an artist who specializes in netart, painting, networked space, installations. All artworks on this site by Stanza
-
88
The Panic Noise Series. 1985
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
94
The Third Space. 2012
Works On Canvas. All 100 cm by 100 cm and signed.
-
120
Living Systems 2023
Invisible Landscape: Germany. A dynamic generative artwork using transport, weather, pollution data
-
58
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
121
Velocity 2019- 2023
This artwork uses a custom made software APP which tracks the audience, and the data collected is represented as a visual collage .
-
108
The Nemesis Machine. Manifestation
A large installation adapted to each place where it is displayed that is a miniature city.
-
54
Control Series. 1990.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
36
The Reader. Data Sculture. 2015.
Digital artwork by Stanza
-
67
The Nemesis Machine. 2010-2019.
All artworks on this site by Stanza
-
113
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
11
Parallel Realities. 2004-2010.
Stanza is an artist who specializes in the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
13
The Reader. 2015.
Stanza is an artist who specializes in netart, painting, networked space, installations. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
109
Youth Culture. 2018.
A large installation sculpture adapted to each place where it is displayed.
-
59
Visitors To A Gallery. 2004+
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
74
Sonicity. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. Artwork has been shown at The Venice Biennale, Tate Britain, The Victoria and Albert Museum. Recipient of Nesta Dreatime Award, AHRC creative fellowship and numerous prizes. Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
-
32
Amorphoscapes. 2004.
Custom hardware and complex software systems as art.
-
124
The Nemesis Machine. Manifestation 2023
a large installation adapted to each place where it is displayed
-
112
Youth Culture 2018.
A large installation sculpture adapted to each place where it is displayed.
-
30
Body. 0100001001101111011001. 2014
A series of artworks about the city. The idea is to go deeper into analogies for the organic identity of the city. All artworks on this site by Stanza
-
15
The Nemesis Machine. 2010-2019.
Stanza. A series of artworks based on connecting city spaces. sults are visualisations and sonifications of real time spaces using my own wireless sensor networks and environmental sensor technologies
-
50
Virus Codex. 2008.
All artworks on this site by Stanza
-
53
Parallel Reality. 2004-2010.
Images made using custom made software and computer techniques developed by the artist. Most images below show events captured from CCTV and live feeds from networked devices. All Image available for exhibition.
-
75
You Are My Subjects. 2004.
Stanza, netart, painting, networked space, installations.
-
72
I Am Alive.2023 .
Ai and data artwork available for exhibition.
-
98
Herd Above The Noise.
Installation
-
86
The Panic Noise Series. 1985.
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
07
Sonicity. 2010.
Stanza is an artist who specializes in netart, painting, networked space, installations. The urban landscape, surveillance culture, privacy and alienation in the city.
-
87
The Panic Noise Series. 1985.
Electronic Analogue Art and Video Art 1985. All artworks on this site by Stanza
-
37
The Nemesis Machine. 2010-2017.
Intelligent city. Evolving artwork The City as System
-
96
Lost In Translation. 2015.
Portait Of The Artist Stanza
-
70
Fortuna. 2010
The computer manipulates time experiences.
-
43
Generative Artworks 2004.
Artwork Underlying these simple interfaces and engaging forms are sophisticated formal and technical structures.
-
111
Youth Culture 2018.
A large installation sculpture adapted to each place where it is displayed.
-
03
The Nemesis Machine. 2010-2019.
Recurring themes throughout his career include, the urban landscape, surveillance culture, privacy and alienation in the city. All artworks on this site by Stanza
- »
- Pause
Frontpage Slideshow (standalone) | Copyright © 2006-2011 JoomlaWorks Ltd.
|
Welcome: This website shows only artwork made by Stanza; please enjoy. These artworks include installations, public art, generative data, paintings, prints and netart. He is the recipient of twenty five international art prizes and awards. All artwork on this site is made between 1981 and 2026.
News: Winner of Next Nature Prize Eindhoven. Research residency at Diriyah Art Futures Riyadh and STARTS EU arts residency at MEET Milano for my AI work about cities and entanglement. Recent solo exhibitions at Deutsches Museum Nuremberg, Samek Art Museum USA, Heinz Nixdorf Museum Germany, and Jarvenpaa Art Museum Finland. Living Landscapes series of AI and Machine learning systems with global data from my API is upcoming in mysolo show at Metamorf Tondheim Norwayy, Stanza music performance live with Soundcities soundscapes project in Enschede and in Rotterdam. Velocity the new AI machine learning tracking app released and exhibited in three art galleries simultaneously.
Main projects include: The Emergent City, visual artworks informed by idea the city is system of data. Genomixer artworks are made using the artist's DNA sequence. Soundcities an online database and installation of thousands of field recordings from around the world. Sensity visualises the city of environmental data as a living system. Urban Generation incorporates surveillance feeds to make a generative artwork. Visitors to A Gallery and Public Domain uses gallery visitors inside a surveillance system.
Commissions, and exhibition requests welcome. All work is for sale, inquiries via Email:
studio@stanza.co.uk
--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Video channel portfolios.
These areas document various net at, software systems,
AI data paintings and installationsas videos.
All artwork © Stanza [Steve Tanza] 1982- 2026.
INSTAGRAM @ stanza_dna
FACEBOOK @ stanza.dna |
|
|
|